ID: 1173639123_1173639128

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1173639123 1173639128
Species Human (GRCh38) Human (GRCh38)
Location 20:44587098-44587120 20:44587129-44587151
Sequence CCTGTTAGTACTAAGCACTGAAC CAGGGTAAAGACACTGCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 61} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!