ID: 1173649043_1173649061

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1173649043 1173649061
Species Human (GRCh38) Human (GRCh38)
Location 20:44651543-44651565 20:44651587-44651609
Sequence CCCCCGTCCCCGGAGCCCCCGCG GAAGGCGGGCGTCTGGGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 69, 4: 481} {0: 1, 1: 0, 2: 0, 3: 12, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!