ID: 1173649048_1173649061

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1173649048 1173649061
Species Human (GRCh38) Human (GRCh38)
Location 20:44651551-44651573 20:44651587-44651609
Sequence CCCGGAGCCCCCGCGCGCGCTCA GAAGGCGGGCGTCTGGGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 182} {0: 1, 1: 0, 2: 0, 3: 12, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!