ID: 1173671883_1173671891

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1173671883 1173671891
Species Human (GRCh38) Human (GRCh38)
Location 20:44804757-44804779 20:44804771-44804793
Sequence CCTCTCTCCCCCTTCCCACCAAA CCCACCAAACAGAACTAGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!