ID: 1173705158_1173705165

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1173705158 1173705165
Species Human (GRCh38) Human (GRCh38)
Location 20:45104799-45104821 20:45104830-45104852
Sequence CCTCCTGCCCTTTCTTTACCCTG TTAGAATTTAACTTAGCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 535} {0: 1, 1: 0, 2: 0, 3: 13, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!