ID: 1173720323_1173720333

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1173720323 1173720333
Species Human (GRCh38) Human (GRCh38)
Location 20:45252840-45252862 20:45252892-45252914
Sequence CCCTGAGACCTGGAGAACAGTTC CTGTGCTTGGAGTAGGGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132} {0: 1, 1: 0, 2: 1, 3: 11, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!