ID: 1173720324_1173720333

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1173720324 1173720333
Species Human (GRCh38) Human (GRCh38)
Location 20:45252841-45252863 20:45252892-45252914
Sequence CCTGAGACCTGGAGAACAGTTCT CTGTGCTTGGAGTAGGGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 185} {0: 1, 1: 0, 2: 1, 3: 11, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!