ID: 1173729389_1173729394

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1173729389 1173729394
Species Human (GRCh38) Human (GRCh38)
Location 20:45317946-45317968 20:45317959-45317981
Sequence CCTACCTTTTGGACGTTTTCTAG CGTTTTCTAGAGGAGGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105} {0: 1, 1: 0, 2: 0, 3: 14, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!