ID: 1173745948_1173745953

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1173745948 1173745953
Species Human (GRCh38) Human (GRCh38)
Location 20:45437147-45437169 20:45437192-45437214
Sequence CCATGAAACTGTGGTGGTCTTGT CTTGGGCCTCAAGATAATGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 178} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!