ID: 1173770145_1173770149

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1173770145 1173770149
Species Human (GRCh38) Human (GRCh38)
Location 20:45649233-45649255 20:45649266-45649288
Sequence CCAAGCAAACATCTCCCAACTCA CCAGCAGATGTTTCCACAATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 242} {0: 1, 1: 1, 2: 0, 3: 10, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!