ID: 1173785785_1173785788

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1173785785 1173785788
Species Human (GRCh38) Human (GRCh38)
Location 20:45792003-45792025 20:45792016-45792038
Sequence CCATGGGAGCCACTGGCGACGCC TGGCGACGCCGAGCAGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 99} {0: 1, 1: 0, 2: 1, 3: 11, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!