ID: 1173790331_1173790338

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1173790331 1173790338
Species Human (GRCh38) Human (GRCh38)
Location 20:45824057-45824079 20:45824084-45824106
Sequence CCGTCACGTGCTCCCCGGAGGCC AAATCTCAGCCAGCTCCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 177} {0: 1, 1: 0, 2: 2, 3: 25, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!