ID: 1173793051_1173793056

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1173793051 1173793056
Species Human (GRCh38) Human (GRCh38)
Location 20:45840624-45840646 20:45840639-45840661
Sequence CCACCCTCCCTGCAGCTCTACAC CTCTACACCCTCGCCGTGATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 484} {0: 1, 1: 0, 2: 0, 3: 3, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!