ID: 1173794401_1173794403

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1173794401 1173794403
Species Human (GRCh38) Human (GRCh38)
Location 20:45848951-45848973 20:45848968-45848990
Sequence CCTTCACTTCTCTGAGCAGTGTG AGTGTGCTTATTTGCAAACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 305} {0: 1, 1: 0, 2: 1, 3: 65, 4: 619}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!