ID: 1173809688_1173809698

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1173809688 1173809698
Species Human (GRCh38) Human (GRCh38)
Location 20:45948299-45948321 20:45948331-45948353
Sequence CCCAAAAGCCAGACTCTTGCTGG CCCACAGTGAGCGAAGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149} {0: 1, 1: 0, 2: 1, 3: 12, 4: 176}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
9 20:45948299-45948321 CCCAAAAGCCAGACTCTTGCTGG - 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG +