ID: 1173823533_1173823536

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1173823533 1173823536
Species Human (GRCh38) Human (GRCh38)
Location 20:46033113-46033135 20:46033135-46033157
Sequence CCCAATTTTTAGTCAGGAAGAGA ATTGGTTTTATAACAGAGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 28, 4: 774}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!