ID: 1173855989_1173855997

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1173855989 1173855997
Species Human (GRCh38) Human (GRCh38)
Location 20:46251184-46251206 20:46251220-46251242
Sequence CCACAGGCGCCCCAGCAGCGTCG CAGCAGCAGCAGCAGTAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 212} {0: 1, 1: 12, 2: 79, 3: 257, 4: 979}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!