ID: 1173877111_1173877114

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1173877111 1173877114
Species Human (GRCh38) Human (GRCh38)
Location 20:46380297-46380319 20:46380313-46380335
Sequence CCATATCCTGTGGAGGAAAATAA AAAATAAGCAAATATAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 252} {0: 1, 1: 0, 2: 5, 3: 117, 4: 1366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!