ID: 1173878083_1173878091

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1173878083 1173878091
Species Human (GRCh38) Human (GRCh38)
Location 20:46389142-46389164 20:46389167-46389189
Sequence CCAGCTCCTTCATGGCATCCAGC GGTCTCCATGTTGGATGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 279} {0: 2, 1: 0, 2: 2, 3: 8, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!