ID: 1173884192_1173884197

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1173884192 1173884197
Species Human (GRCh38) Human (GRCh38)
Location 20:46442363-46442385 20:46442391-46442413
Sequence CCACAGTTTGTTTAACCCAGTGA ATCTAGATTGTTTTCAGTTTTGG
Strand - +
Off-target summary No data {0: 3, 1: 8, 2: 65, 3: 340, 4: 1250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!