ID: 1173888997_1173889012

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1173888997 1173889012
Species Human (GRCh38) Human (GRCh38)
Location 20:46489118-46489140 20:46489168-46489190
Sequence CCCCGACCCCCTTCCCCCTCTAT CAGTACCAACATGATGAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 438} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!