ID: 1173910897_1173910905

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1173910897 1173910905
Species Human (GRCh38) Human (GRCh38)
Location 20:46670054-46670076 20:46670100-46670122
Sequence CCTAGAAGGTGCACTGGGAGGCT CACCCATATGTAGCTTCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 239} {0: 1, 1: 0, 2: 0, 3: 11, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!