ID: 1173927567_1173927578

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1173927567 1173927578
Species Human (GRCh38) Human (GRCh38)
Location 20:46792199-46792221 20:46792230-46792252
Sequence CCCTCCCGCCTCACCTTATCTGG CCTGCCTTCCAACCTCTAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 175} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!