ID: 1173928985_1173928990

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1173928985 1173928990
Species Human (GRCh38) Human (GRCh38)
Location 20:46802812-46802834 20:46802840-46802862
Sequence CCTGCAGTTCACGCATGCCCACT GATGGGATAATGCCTCATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 81} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!