ID: 1173944716_1173944722

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1173944716 1173944722
Species Human (GRCh38) Human (GRCh38)
Location 20:46941339-46941361 20:46941379-46941401
Sequence CCACCGGAAGTAGAACGAAACTC TCTTCTGCTCCTCAGCTGTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!