ID: 1174003513_1174003519

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1174003513 1174003519
Species Human (GRCh38) Human (GRCh38)
Location 20:47392049-47392071 20:47392082-47392104
Sequence CCTCAACACATGGCTTCCACCTT AGAGTCACTCCAGCTCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 330} {0: 1, 1: 0, 2: 0, 3: 20, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!