ID: 1174008751_1174008754

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1174008751 1174008754
Species Human (GRCh38) Human (GRCh38)
Location 20:47431773-47431795 20:47431788-47431810
Sequence CCAGGCATGAGCCATGGTGCCCA GGTGCCCAGCTTGCCCAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 6, 3: 69, 4: 527}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!