ID: 1174032234_1174032240

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1174032234 1174032240
Species Human (GRCh38) Human (GRCh38)
Location 20:47639076-47639098 20:47639129-47639151
Sequence CCTGTTTCTGTTGGCTCAAGTCC GTTACCAAAGCAACCCATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 165} {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!