ID: 1174069282_1174069287

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1174069282 1174069287
Species Human (GRCh38) Human (GRCh38)
Location 20:47888516-47888538 20:47888556-47888578
Sequence CCAGTGAGGGGTCATCCCTGCTG GTGACTCCCCATCCCCATGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 15, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!