ID: 1174076768_1174076775

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1174076768 1174076775
Species Human (GRCh38) Human (GRCh38)
Location 20:47942805-47942827 20:47942843-47942865
Sequence CCTGGGGCTTGTGGTCAGATACC CGCTGTGTGTCGAGGGCATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!