ID: 1174087244_1174087254

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1174087244 1174087254
Species Human (GRCh38) Human (GRCh38)
Location 20:48018164-48018186 20:48018185-48018207
Sequence CCCTCTGTACCCATGGCCTCCTG TGTCCAGAAGGCCCTTGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 20, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!