ID: 1174094262_1174094274

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1174094262 1174094274
Species Human (GRCh38) Human (GRCh38)
Location 20:48075543-48075565 20:48075581-48075603
Sequence CCACCACTGCCCTCATCTGCAGG CCTTGAGCTCATGGGTGCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 28, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!