ID: 1174173175_1174173183

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1174173175 1174173183
Species Human (GRCh38) Human (GRCh38)
Location 20:48629486-48629508 20:48629504-48629526
Sequence CCCCCAGGCGGTAGCAGAGCTCC GCTCCGAGGAGATGGGGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 143} {0: 1, 1: 0, 2: 1, 3: 34, 4: 406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!