ID: 1174174472_1174174482

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1174174472 1174174482
Species Human (GRCh38) Human (GRCh38)
Location 20:48636239-48636261 20:48636274-48636296
Sequence CCCTCCCACTGGGACAGAAGATC GACTCTGTTTTGTTCACTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 35, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!