ID: 1174215322_1174215334

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1174215322 1174215334
Species Human (GRCh38) Human (GRCh38)
Location 20:48911977-48911999 20:48912024-48912046
Sequence CCACTACAGTTAGGTTCCCCAGA GGTGCAAATGGTTTATTTGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!