ID: 1174216727_1174216736

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1174216727 1174216736
Species Human (GRCh38) Human (GRCh38)
Location 20:48921705-48921727 20:48921752-48921774
Sequence CCAGTCACGTGGTCACGTGACGC GCCGAGGTGTCGCTTCCTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 207} {0: 1, 1: 0, 2: 1, 3: 1, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!