ID: 1174236296_1174236304

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1174236296 1174236304
Species Human (GRCh38) Human (GRCh38)
Location 20:49095438-49095460 20:49095477-49095499
Sequence CCTGTCAGCCTTCCAAGTAGCTA GCTAATTTTTTATTTTTTTGTGG
Strand - +
Off-target summary {0: 2, 1: 12, 2: 124, 3: 703, 4: 1481} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!