ID: 1174291180_1174291186

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1174291180 1174291186
Species Human (GRCh38) Human (GRCh38)
Location 20:49509840-49509862 20:49509885-49509907
Sequence CCCTTTTCCCTCAATCCCTGCAG TTTTTTTTTTTTTTTTTTTCTGG
Strand - +
Off-target summary No data {0: 475, 1: 20606, 2: 19351, 3: 44622, 4: 187008}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!