ID: 1174294981_1174294993

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1174294981 1174294993
Species Human (GRCh38) Human (GRCh38)
Location 20:49539539-49539561 20:49539567-49539589
Sequence CCCCACCCACTGGGGCCCCCATG TACCCACTGACAGGGAGCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 27, 3: 23, 4: 312} {0: 1, 1: 0, 2: 0, 3: 11, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!