ID: 1174353828_1174353841

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1174353828 1174353841
Species Human (GRCh38) Human (GRCh38)
Location 20:49985623-49985645 20:49985672-49985694
Sequence CCCTTGAAATGTATCATTGCGGT AATGGTGGGCCCAGTGGGTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!