ID: 1174359594_1174359606

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1174359594 1174359606
Species Human (GRCh38) Human (GRCh38)
Location 20:50019715-50019737 20:50019763-50019785
Sequence CCTATCTCCCTCTCAGGCCAAAC CAGTAGTTGCTCAGGGAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 26, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!