ID: 1174386725_1174386738

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1174386725 1174386738
Species Human (GRCh38) Human (GRCh38)
Location 20:50191746-50191768 20:50191786-50191808
Sequence CCGCTGACGCCAAGGCGCCCCCG GGCCGCGCCGGCGCCCTCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88} {0: 1, 1: 0, 2: 5, 3: 31, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!