ID: 1174401936_1174401948

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1174401936 1174401948
Species Human (GRCh38) Human (GRCh38)
Location 20:50280675-50280697 20:50280723-50280745
Sequence CCTCTTTCTCTCTTCCTTGTGTA GCAGGCAGAGACCCCTGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 72, 4: 810} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!