ID: 1174405176_1174405178

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1174405176 1174405178
Species Human (GRCh38) Human (GRCh38)
Location 20:50298284-50298306 20:50298303-50298325
Sequence CCAAGGGTGTCCTTGTGTCTTTT TTTTTGTCATTCATCCCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 263} {0: 1, 1: 1, 2: 3, 3: 11, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!