ID: 1174417917_1174417925

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1174417917 1174417925
Species Human (GRCh38) Human (GRCh38)
Location 20:50379696-50379718 20:50379734-50379756
Sequence CCTAGAAGCTTCCTCAGAAAACC GGGTTCCCAGCAGGACAGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 27, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!