ID: 1174418442_1174418448

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1174418442 1174418448
Species Human (GRCh38) Human (GRCh38)
Location 20:50383493-50383515 20:50383512-50383534
Sequence CCATCCTGAGACTTGTTTTATCC ATCCCCTCAGTTTCAGGAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 12, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!