ID: 1174443498_1174443502

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1174443498 1174443502
Species Human (GRCh38) Human (GRCh38)
Location 20:50574986-50575008 20:50575010-50575032
Sequence CCTTCTTTGTGGTCCTCAGTCTT GAGTCTGAAGAGAGGGAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 100, 4: 902}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!