ID: 1174460343_1174460356

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1174460343 1174460356
Species Human (GRCh38) Human (GRCh38)
Location 20:50678108-50678130 20:50678151-50678173
Sequence CCCCCCAAGAAGAGAACCAGCCA GCTGATATAGCAAAGTGTGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 5, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!