ID: 1174479152_1174479154

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1174479152 1174479154
Species Human (GRCh38) Human (GRCh38)
Location 20:50818756-50818778 20:50818779-50818801
Sequence CCTGAATCCTTCTGTTCTCTCTG CTTTTACCTCCTACTCTGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!