ID: 1174482541_1174482552

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1174482541 1174482552
Species Human (GRCh38) Human (GRCh38)
Location 20:50841759-50841781 20:50841810-50841832
Sequence CCCTCAGGCCTTCGTCAAGATGG AGACGTGCTTCAGGCTGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71} {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!